Skip to content

uboczne skutki narkozy

4 miesiące ago

532 words

Starter do przodu był GACAGCAGATCACGATTCTC (odpowiadający promotorowi łańcucha ciężkiego .-sercowej miozyny). Startery odwrotne były TCCTTAGGCTTGCTCTTGC (odpowiadające miejscu mirystoilacji białka transgenu) i TTGCCACCATTGCACGTAC (odpowiadające endogennym sekwencjom łańcucha ciężkiego miozyny (miozyny) dalszymi niż te w konstrukcie transgenu). Immunoblots. Serie myszy homogenizowano w 10 objętościach 50 mM KCl, 50 mM PIPES (pH 7,4), 10 mM kwasu glikolu etylenowego (bis-2-aminoetylo) -N, N, N a, N a-tetraoctowego, 2 mM MgCl2, i mM DTT w temperaturze 4 ° C z pięcioma 5-sekundowymi impulsami przy 9600 obrotach na minutę, stosując homogenizator Ultra-Turrax T25 (Jahnke and Kunkel, Staufen, Niemcy). Następnie homogenaty odwirowano przy 2200 g przez 15 minut, odzyskano supernatant i powtórzono odwirowanie. Stężenia białka w końcowym supernatancie oznaczano za pomocą odczynnika do oznaczania białka BCA (Pierce Chemical Co., Rockford, Illinois, USA). Próbki o dwudziestu mikrogramach rozdzielono na 10% żelach SDS-PAGE i poddano elektrotranslacji na błonach nitrocelulozowych 0,45 .m (Bio-Rad Laboratories Inc., Hercules, California, USA). Bloty poddano reakcji z rozcieńczeniem 1: 2,500 króliczego przeciwciała poliklonalnego przeciw ludzkiej kaspazie-8 (Idun Pharmaceuticals, San Diego, Kalifornia, USA). Test drabiny DNA. Test drabiny DNA przeprowadzono jak opisano wcześniej (15). TUNEL / kosztowanie aktyny. Oznaczenie TUNEL / oznaczenie aktyny przeprowadzono jak opisano uprzednio (15) z następującymi modyfikacjami odnoszącymi się do kosztowania aktyny. -Aromatycznej. Reakcję TUNEL przeprowadzono przy użyciu zestawu do wykrywania apoptozy TACS 2 TdT DAB (Trevigen Inc., Gaithersburg, Maryland, USA) zgodnie z instrukcjami producenta, z wyjątkiem tego, że streptawidyna użyta do wykrywania końcowej ligazy zdysocjowanej deoksynukleotydylowej (ligacja TdT) ) biotynylowane dNTP zostały chwilowo pominięte. Barwienie dla aktyny. -Aromatycznej przeprowadzono z rozcieńczeniem 1:30 króliczego przeciwciała poliklonalnego (klon 5C5, Sigma-Aldrich). Po inkubacji ze skoniugowanym z TRITC przeciwciałem drugorzędowym skierowanym przeciw króliczym (rozcieńczenie 1:30) w celu wykrycia przeciwciała aktyny. Cedomerycznej, Streptavidin-Orange-Green 488 (rozcieńczenie 1:50; Jackson ImmunoResearch Laboratories Inc., West Grove, Pennsylvania, USA ) zastosowano do wykrywania ligowanych biotynylowanych dNTP w jądrach apoptycznych. Całkowite jądra w każdej sekcji wizualizowano przez barwienie za pomocą 500 ng / ml bisbenzimidu (Hoechst 33258). Skrawki umieszczono na szkiełkowych szkiełkach nakrywkowych (Bellco Glass Inc., Vineland, New Jersey, USA) i wizualizowano za pomocą konfokalnej mikroskopii świetlnej (Zeiss Axiophot, Carl Zeiss Inc., Thornwood, New York, USA). Dla każdej sekcji liczbę zliczeń miocytów TUNEL-dodatnich w wolnej ścianie lewej komory obliczano ręcznie. Badano tylko jądra, które były wyraźnie zlokalizowane w miocytach sercowych. Całkowita liczba jąder w wolnej ścianie lewej komory została określona przez zautomatyzowane zliczanie pozytywnych sygnałów bisbenzimidowych przy użyciu IPLab (Scanalytics Inc., Vienna, Virginia, USA). Dla każdego zwierzęcia analizowano pięć przekrojów poprzecznych rozmieszczonych w sercu. W przypadku kontroli i każdej z trzech linii transgenicznych badano trzy zwierzęta na grupę. Pomiary echokardiograficzne. Badania echokardiograficzne (16) przeprowadzono przy użyciu ultrasonografu HDI 5000cv (Advanced Technologies Laboratories, Andover, Massachusetts, USA). Myszy lekko znieczulono metoksyfluranem i umieszczono w pozycji leżącej na poduszce rozgrzewającej. Przetwornik 10-MHz został nałożony na lewą hemithorax, a dwuwymiarowe obrazy serca w trybie M zarejestrowano na taśmie wideo. Wymiary lewej komory i grubości ścian oceniano na końcu rozkurczu i systolu końcowego zgodnie z wytycznymi Amerykańskiego Towarzystwa Echokardiografii
[więcej w: napięciowy ból głowy, mięsak kości, mielopatia ]

0 thoughts on “uboczne skutki narkozy”

  1. Ja po kilku infekcjach, które u mojego dziecka skończyły się zapaleniem oskrzeli