Skip to content

kosmetyki szkodliwe i rakotwórcze

2 miesiące ago

576 words

Panel hybrydowy promieniowania genomu całego Genebridge 4 (Invitrogen, Karlsruhe, Niemcy) przeszukiwano przez PCR stosując startery specyficzne dla HCN4. Reakcje PCR przeprowadzono z użyciem 25 ng DNA dla wszystkich 93 hybrydowych klonów oraz z kontrolą genomowego DNA u ludzi i chomików. Dwie niezależne reakcje PCR amplifikujące fragmenty genomowe odpowiednio egzonu / intronu lub eksonu 8, zastosowano do analizy chromosomalnej lokalizacji genu HCN4. Startery pochodziły z genomowych sekwencji genu HCN4 zidentyfikowanych jak opisano powyżej. Warunki były następujące: dla PCR A (starter AAAGCCGTGGAGCGCGAACAGGAG [sens] i starter CCCAGCGCAAGGCAGGAAAGTTA [antysensowny]), 5 minut w 95 ° C (1 cykl) i 30 sekund w 95 ° C, 30 sekund w 65 ° C i 45 sekund w 72 ° C (30 cykli) w buforze zawierającym 5% DMSO i polimerazę Taq (Invitrogen); i dla PCR B (starter TGCCACCCCCTCTGTCTTTGTTTG [sens] i starter CCTCCCTCCCCCTCCCTCCCTCTA [antysensowny]), 5 minut w 95 ° C (1 cykl) i 30 sekund w 95 ° C, 30 sekund w 62 ° C i 30 sekund w 72 ° C (30 cykli) w buforze zawierającym 5% DMSO i polimerazę Taq (Invitrogen). Produkty PCR rozdzielono za pomocą elektroforezy w żelu agarozowym. Wyniki PCR zostały przesłane do serwera mapowania radiacyjnego hybrydowego w Whitehead Institute (http://www.genome.wi.mit.edu/cgi-bin/contig/rhmapper). Dla wyniku LOD wybrano odcięcie 15 punktów. Figura 2 Detekcja mutacji w genie HCN4. (a) Ludzki gen HCN4 składa się z ośmiu eksonów. Minimalna wielkość eksonu wynosiła 141 pz (ekson 5), a maksymalna wielkość wynosiła 1465 pz (ekson 8); największym intronem był intron (. 24 kb) i najmniejszy intron 5 (102 pb). Domeny funkcjonalne kanału HCN4 typu dzikiego są przedstawione poniżej. P, obszar porów; 1-6, domeny transbłonowe. (b) Elektroforogram po bezpośrednim sekwencjonowaniu pacjenta indeksu z SND. Heterozygotyczna delecja 1-bp (1631delC) w HCN4 dała nakładający się wzór sekwencji składający się z sekwencji ekson 5 typu dzikiego i zmutowanego. (c) Mutacja heterozygotyczna z delecją indukuje miejsce restrykcyjne EciI w eksonie 5; po analizie enzymem restrykcyjnym, niecięty fragment typu dzikiego (380 bp) i dwa fragmenty EciI (200 i 180 bp, wycięty fragment mutanta) znaleziono w indeksie pacjenta. Jej troje zdrowych dzieci miało konfigurację typu dzikiego. Lewa linia pokazuje standard wielkości w parach zasad (pUC19 DNA / MspI). (d) Schematyczna topologia kanałów HCN4 z sześcioma segmentami transbłonowymi (S1-S6) i wewnątrzkomórkowymi N- i C-końcowymi. Ze względu na przesunięcie ramki odczytu w sekwencji nukleotydowej, powstały przedwczesny kodon stop spowodował delecję cNBD zlokalizowanego na C-końcu w HCN4-573X, który został zastąpiony przez 29 nowych aminokwasów (gruba szara linia). Względne rozmiary segmentów transbłonowych i N- lub C-końca nie są narysowane w skali. Do przeszukiwania mutacji opracowano intronowe startery (Tabela 1), które obejmowały kompletną sekwencję kodującą, miejsca splicingowe i sąsiednie miejsca laryczne. Ze względu na duży rozmiar lub wysoką zawartość CG, eksony i 8 podzielono na odpowiednio 2 i 5 amplikonów. Genomowy DNA ekstrahowano z obwodowych limfocytów pacjentów, członków rodziny i osób kontrolnych, stosując standardowe techniki (26). W sumie 181 niespokrewnionych i zdrowych osobników (26) służyło jako kontrole do weryfikacji zmian sekwencji od opublikowanej sekwencji cDNA HCN4. Sekwencjonowanie produktów PCR i rozdział produktów sekwencjonowania przeprowadzono stosując BigDye RR Terminator AmpliTaq-Kit wersja 3.0 i system ABI3700 (Perkin-Elmer Applied-Biosystems, Weiterstadt, Niemcy). Elektroferogramy porównano z sekwencją dzikiego typu HCN4 (numer dostępu GenBank AJ238850) przy użyciu programu SeqMan 5.0 (DNASTAR Inc., Madison, Wisconsin, USA). Tabela Startery genomowe (5 a-3 (3) zastosowane do całkowitej amplifikacji egzonu genu HCN4 Generowanie konstruktów ekspresyjnych dzikiego typu i zmutowanych HCN4 Immunocytochemia
[hasła pokrewne: miód rzepakowy właściwości, olx strzelin, napięciowe bóle głowy ]

0 thoughts on “kosmetyki szkodliwe i rakotwórcze”